rs61907501 chr12:3300364 C>T
- Sequence
gtgattgcttggtttcccttttca[C/T]gacctgcagatcccaacactccag
- ASB in cell types
- HEK293 (embryonic kidney) Detroit 562 (Pharyngeal squamous cell carcinoma)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 0.14 | 2.46 | 1.89 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Colon_Transverse, Skin_Sun_Exposed_Lower_leg