rs61957221 chr13:76019596 A>G
- Sequence
ccgaagccccagtgggcctgtgtt[A/G]cagtgtgctctttgagttctgccg
- ASB in cell types
- VCaP (prostate carcinoma) HCT-116-RAD21-mAC GM18526 (B – cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| VCaP (prostate carcinoma) | n/a | 2.55 | 2.00 | |||
| HCT-116-RAD21-mAC | -1.58 | 1.64 | 1.00 | |||
| GM18526 (B – cells Lymphoblastoid Cell Lines) | -0.78 | 1.34 | 1.00 |
Items per page:
1 – 3 of 3