rs62045835 chr15:37133942 C>T
- Sequence
aacaaagaaagattttacttagtt[C/T]agtatggtgtaaaggctggttggt
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 2.69 | -2.48 | 1.00 | |||
| H929 (plasma cell myeloma) | -2.00 | 2.37 | 1.00 |
Items per page:
1 – 2 of 2