rs62057830 chr16:68757280 G>A
- Sequence
tttttgtatttttagtagagacag[G/A]gtttcaccatgttggccaggctgg
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | -1.15 | 1.73 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -1.47 | 1.61 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood