rs62119810 chr19:2648841 A>G
- Sequence
tgccctccaccttgcagggcagct[A/G]tgaacataatccttcaactctgaa
- ASB in cell types
- foreskin keratinocyte K562 (myelogenous leukemia) erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -2.83 | 3.08 | 1.00 | |||
| K562 (myelogenous leukemia) | 0.67 | -0.07 | 1.98 | |||
| erythroid cells | 1.91 | -1.39 | 1.50 |
Items per page:
1 – 3 of 3