rs62179504 chr2:200303032 T>C
- Sequence
ccacgcaccttgatgttgcagcac[T/C]aggaagaaaagaatgcggtgactg
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- SPI1_HUMAN NC2A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.21 | -1.47 | 2.00 | n/a | No Hit | |||
| NC2A_HUMAN | 2.33 | -4.79 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid