rs62218081 chr22:20175103 G>A
- Sequence
accagcagggagagcccacggagc[G/A]ggagggcctgtggggctcagccct
- ASB in cell types
- glioblastoma patient-derived cell model MOLM-13(acute monocytic leukemia(AML), Homo sapiens)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma patient-derived cell model | -1.57 | 1.57 | 1.00 | |||
| MOLM-13(acute monocytic leukemia(AML), Homo sapiens) | -2.00 | 2.38 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Thyroid