rs62233383 chr3:16060631 G>T
- Sequence
atgctgttgcagccacgtgcatcg[G/T]caccccagcttccaccacatagat
- ASB in cell types
- adrenal gland tibial nerve heart left ventricle breast tumor
- ASB for transcription factors
- CTCF_HUMAN ESR1_HUMAN EPAS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.83 | 0.00 | 1.57 | n/a | No Hit | |||
| ESR1_HUMAN | 2.79 | -5.12 | 2.00 | n/a | No Hit | |||
| EPAS1_HUMAN | -0.26 | 1.06 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid