rs62273902 chr3:156826699 C>G
- Sequence
agggggaacggggttagaaaggga[C/G]agatttgaaagccattccagcagt
- ASB in cell types
- HEK293T (embryonic kidney) MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- LMBL2_HUMAN PRDM9_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| LMBL2_HUMAN | n/a | 2.18 | 2.00 | n/a | n/a | |||
| PRDM9_HUMAN | -0.70 | 2.77 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Pancreas, Skin_Sun_Exposed_Lower_leg, Thyroid