rs62273904 chr3:156826787 T>C
- Sequence
tgccgcttcaggaaagtcttagga[T/C]gtgaactcccgccttcacctgccc
- ASB in cell types
- HEK293T (embryonic kidney) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293T (embryonic kidney) | -0.44 | 1.40 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | 1.87 | -1.49 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Pancreas, Skin_Sun_Exposed_Lower_leg, Thyroid