rs62319099 chr4:87374356 T>G
- Sequence
aagagaatctgaaagcaaactgga[T/G]tcacctttataaaatcacagacga
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| TTC-1240 (Rhabdoid tumor of the kidney) | -0.48 | 1.68 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Colon_Transverse, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pituitary, Spleen, Thyroid, Whole_Blood