rs62319100 chr4:87374387 G>A
- Sequence
ttataaaatcacagacgatgactc[G/A]gatggtccccaactcctttcttta
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney)
- ASB for transcription factors
- SMRC1_HUMAN SMCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMRC1_HUMAN | -2.56 | 2.48 | 1.00 | n/a | n/a | |||
| SMCA4_HUMAN | -0.43 | 1.93 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Colon_Transverse, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Pituitary, Spleen, Thyroid, Whole_Blood