rs62328640 chr4:155629279 G>T
- Sequence
tcccatagcattccacataaagtg[G/T]tctggaaaacaattcatcagtgag
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 2.24 | -0.34 | 2.33 | n/a | No Hit |
Items per page:
1 – 1 of 1