rs62362870 chr5:77867136 G>A
- Sequence
gtaactgtccttagtggcagaggg[G/A]ttagaaagtctacaatttaagaat
- ASB in cell types
- foreskin keratinocyte GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.47 | -4.70 | 2.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.04 | 1.85 | 1.00 |
Items per page:
1 – 2 of 2