rs62395345 chr6:31494003 A>G
- Sequence
cgccctgggccgcgctggtcttgt[A/G]tcatttcagtggtccctcccgtct
- ASB in cell types
- adult erythroblasts
- ASB for transcription factors
- KDM6A_HUMAN RBBP5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM6A_HUMAN | 2.39 | n/a | 2.00 | n/a | n/a | |||
| RBBP5_HUMAN | 2.93 | -5.44 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood