rs62418207 chr6:62523643 A>T
- Sequence
cttgatattggttaatgcagttta[A/T]ctattcctttaccctgctgtgttt
- ASB in cell types
- embryonic stem cell-derived pancreatic cells
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| embryonic stem cell-derived pancreatic cells | -0.64 | 1.63 | 1.00 |
Items per page:
1 – 1 of 1