rs6246 chr12:27969960 A>G
- Sequence
ctgaagtcagcttctttgcgaacc[A/G]ggccctttcgttccagagccactt
- ASB in cell types
- HEK293 (embryonic kidney) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.01 | 0.79 | 2.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.84 | -1.16 | 1.00 |
Items per page:
1 – 2 of 2