rs62493403 chr8:26667563 A>G
- Sequence
atgccatggcaacatcaggaagtt[A/G]ccctctatggtctaaaagggggag
- ASB in cell types
- macrophages form periferal blood GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- SPI1_HUMAN SRF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.82 | -0.49 | 2.00 | -0.24 | Weak Concordant | |||
| SRF_HUMAN | 1.75 | -1.52 | 1.00 | 1.29 | Weak Discordant |
Items per page:
1 – 2 of 2
Motif analysis
