rs62493952 chr8:5971043 G>C
- Sequence
ttatcatcaccgcagagggagaga[G/C]gggaggccggcaacttcttcacaa
- ASB in cell types
- bipolar neuron IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | -2.44 | 2.82 | 1.00 | |||
| IPSC-derived bipolar neuron | -1.50 | 1.71 | 1.00 |
Items per page:
1 – 2 of 2