rs62517842 chr8:130651334 C>T
- Sequence
acaattattcccttcatgctgaga[C/T]ttggaatctcttggctcagggtgt
- ASB in cell types
- foreskin keratinocyte esophagus squamous epithelium
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.25 | n/a | 2.83 | |||
| esophagus squamous epithelium | 2.56 | 0.28 | 1.00 |
Items per page:
1 – 2 of 2