rs62522651 chr8:95225668 C>T
- Sequence
cgatctgtggcaaggtcccctgcc[C/T]tagaagccgctgagtcacaccgag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma) breast tumor
- ASB for transcription factors
- ESR1_HUMAN ETV2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.25 | 0.17 | 3.24 | n/a | No Hit | |||
| ETV2_HUMAN | 3.11 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2