rs62560444 chr9:83219890 G>A
- Sequence
agcagagccgacagtgtggtttct[G/A]gctaattccggctgcagcctggtt
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines) foreskin keratinocyte GBM39 (Human brain tumor)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 4.52 | 1.28 | 2.00 | n/a | n/a | |||
| CTCF_HUMAN | 1.77 | 0.86 | 2.01 | n/a | No Hit |
Items per page:
1 – 2 of 2