rs6259 chr17:7633209 G>A
- Sequence
ttgcactacctccctctaggagaa[G/A]actcttccacctctttttgcctga
- ASB in cell types
- HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | 1.80 | -0.56 | 1.10 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP asthma, birth weight, diastolic blood pressure (dbp), hdl cholesterol change with statins, height, serum dihydrotestosterone (dht) level, serum testosterone (t) level, sex hormone-binding globulin (shbg) concentrations, sporadic creutzfeldt-jakob disease, triglycerides
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood