rs6289 chr4:47406692 A>G
- Sequence
tttctctttcacaggaatcacgac[A/G]gtgcttacaatgacaaccatcagc
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 1.74 | -1.51 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, height, ldl cholesterol change with statins, obesity with early age of onset (age >2), prop taste detection threshold, resistance to kuru in aged women despite likely exposure, rheumatoid arthritis, total cholesterol, weight change (kg/y) in children, years of education
GTEx eQTL Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia