rs636649 chr17:8991732 C>G
- Sequence
gggtgctggtattttaggaagagg[C/G]gtttgctcctccagaggagagagg
- ASB in cell types
- Peyer's patch glioblastoma cells GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | -4.24 | 3.92 | 1.00 | |||
| glioblastoma cells | 1.89 | n/a | 1.50 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.29 | -0.46 | 1.00 |
Items per page:
1 – 3 of 3