rs638702 chr3:107642144 C>T
- Sequence
catcattttcagtactacaaattg[C/T]gtaatgtgtatgaggccactgttg
- ASB in cell types
- THP-1 (acute monocytic leukemia)
- ASB for transcription factors
- CEBPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPA_HUMAN | 2.49 | -4.13 | 1.50 | 1.72 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), age at death with kuru exposure, alzheimers disease, ldl cholesterol change with statins, rheumatoid arthritis, serum creatinine, total cholesterol change with statins, triglycerides, waist hip ratio