rs6413916 chr1:201170488 G>A
- Sequence
aaaatgcactcatctggatgctca[G/A]tttttaccagtagtagcccacatg
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.82 | 0.20 | 1.17 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -0.06 | 1.03 | 1.11 |
Items per page:
1 – 2 of 2