rs6414121 chr2:189060587 G>C
- Sequence
cctcatctacaaaatggagataat[G/C]atagtacctagtacatagggctgc
- ASB in cell types
- 22RV1 (prostate carcinoma) MDA-MB-134 (invasive lobular breast carcinoma)
- ASB for transcription factors
- ANDR_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 0.13 | 2.62 | 2.50 | n/a | No Hit | |||
| ESR1_HUMAN | -0.09 | 1.01 | 1.53 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, fasting insulin, height, homa-b, homa-ir, major depressive disorder (broad definition), major depressive disorder (broad definition) (females), major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), microalbuminuria
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Colon_Sigmoid, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid