rs6415788 chr9:4118111 G>T
- Sequence
gcatggtaagggggtggggggcct[G/T]ggggcggcggcagaggagggagcg
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.30 | 1.28 | 1.36 | n/a | n/a |
Items per page:
1 – 1 of 1