rs6418333 chrX:85851592 T>C
- Sequence
gttttcaggatttgaacatgtgaa[T/C]gacttgcaccacatactgccggca
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) ID00014 (lymphoblastoid cell, DiGeorge syndrome) liver
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | 3.36 | n/a | 1.33 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | n/a | 3.27 | 2.00 | |||
| liver | 2.07 | -4.53 | 2.00 |
Items per page:
1 – 3 of 3