rs6419156 chr4:100827029 G>A
- Sequence
tggctatgtatgaggcaagcagtc[G/A]atatggcttgtgtaattaattttc
- ASB in cell types
- fetal bone marrow-derived mononuclear cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| fetal bone marrow-derived mononuclear cells | 2.13 | -1.66 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, bipolar disorder in alcoholics, homa-b, longstanding arthritis, lp-pla2 mass, paternal transmission distortion, rheumatoid arthritis, urinary albumin-to-creatinine ratio