rs6421690 chr11:64522945 A>C
- Sequence
cctctgttcaattccacaaaaacc[A/C]tttgctcctaattgcccaggcttt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.64 | 1.97 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP childhood acute lymphoblastic leukemia, common carotid artery thickness (average of near and far wall measures), internal carotid artery thickness (average of near and far walls), ldl cholesterol, nicotine dependence (smoking), smoking cessation in a trial of precessation nicotine replacement, total cholesterol