rs6421985 chr11:280221 A>C
- Sequence
gagagcgccgccccggaggaggcg[A/C]tggggcccgcggaagagcctgagc
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) primary B-CLL cells
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 0.20 | 2.59 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Esophagus_Mucosa, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Stomach, Whole_Blood