rs6422908 chr15:27326584 G>A
- Sequence
tcttcacactttgtatatttattg[G/A]aacttaagatttatagtatgtcac
- ASB in cell types
- LNCaP (prostate carcinoma) 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | -0.24 | 1.24 | 1.65 | |||
| 22RV1 (prostate carcinoma) | 2.81 | -5.04 | 2.00 |
Items per page:
1 – 2 of 2