rs6422909 chr15:27326696 T>C
- Sequence
aaccagtctctatcagaaagagaa[T/C]tggggaggtgaggatgtcaacatg
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 0.13 | 1.11 | 1.71 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cognitive response of healthy volunteers to topiramate treatment as measure by the digit span backward cognitive test, cognitive response of healthy volunteers to topiramate treatment as measure by the symbol search cognitive test, variant creutzfeldt-jakob disease