rs6423129 chrX:121322352 G>A
- Sequence
actcaaatgcaaccttgcagccag[G/A]gggagctatttctgacagctctca
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) SK-N-SH (neuroblastoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.71 | 0.33 | 2.02 | -0.50 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
