rs6425081 chr1:187185550 C>A
- Sequence
tcccgtagagctattttatacacc[C/A]cgttgtttacctgatgtttcctca
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| ZR-75-1 (invasive ductal carcinoma) | n/a | 2.32 | 4.00 |
Items per page:
1 – 1 of 1