rs6425611 chr1:180157972 A>C
- Sequence
aagtcacagagggctaatctgatc[A/C]ccagaggccttcatgccagtagtt
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- MEF2B_HUMAN FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | -3.79 | 3.47 | 1.00 | n/a | No Hit | |||
| FOXA1_HUMAN | 0.30 | 1.59 | 2.53 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, diastolic blood pressure (dbp), ldl cholesterol, lp-pla2 activity, maternal transmission distortion, tetrology of fallot, total cholesterol
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood