rs6425874 chr1:30180396 C>G
- Sequence
aaaaccacattatcagcacatcaa[C/G]tgcagaactgttctgcgaatgcat
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- SOX6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SOX6_HUMAN | 2.25 | -1.91 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, college completion, obesity with early age of onset (age >2), urinary albumin-to-creatinine ratio, years of education