rs6426508 chr1:228647119 T>A
- Sequence
ggtaggcagcccccttttgagcag[T/A]ccggaatagggtggaggggtttga
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.52 | 1.07 | 3.62 | |||
| HEK293T (embryonic kidney) | 0.07 | 1.08 | 2.12 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Testis