rs6426545 chr1:226815177 C>T
- Sequence
agagggaagagtgactaagccgga[C/T]gctccatccaggcaggaaaaccgt
- ASB in cell types
- keratinocytes HEK293 (embryonic kidney) breast tumor pulmonary artery endothelial cell
- ASB for transcription factors
- SNAI2_HUMAN ESR1_HUMAN TBP_HUMAN FEZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SNAI2_HUMAN | 3.19 | n/a | 1.50 | n/a | No Hit | |||
| ESR1_HUMAN | 2.62 | 0.99 | 2.80 | n/a | No Hit | |||
| TBP_HUMAN | -0.11 | 1.39 | 1.50 | n/a | No Hit | |||
| FEZF1_HUMAN | n/a | 3.21 | 4.00 | n/a | No Hit | |||
| EP300_HUMAN | 0.77 | 1.61 | 1.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, height, ldl cholesterol, ldl cholesterol change with statins, total cholesterol, total cholesterol change with statins
GTEx eQTL Brain_Hypothalamus, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid