rs6427847 chr1:200700052 A>G
- Sequence
actggaggatcagcttccctggtg[A/G]gtcactcatatagctgtcaagttg
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) MDM(monocyte derived macrophages) macrophages form periferal blood TALL1 (T-Acute Lymphoblastic Leukemia)
- ASB for transcription factors
- SPI1_HUMAN ETS1_HUMAN FLI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.74 | 1.90 | 1.44 | n/a | No Hit | |||
| ETS1_HUMAN | 3.54 | -3.68 | 1.00 | n/a | No Hit | |||
| FLI1_HUMAN | 2.69 | -2.43 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, bipolar disorder, body mass index (bmi), ldl cholesterol, resistance to kuru in aged women despite likely exposure, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood