rs6427909 chr1:201462047 G>C
- Sequence
tcggtctccccaccccacctcatc[G/C]gactcccagctgcctggctgagac
- ASB in cell types
- monocytes from periferal blood HKC8 (kidney proximal tubule cell line)
- ASB for transcription factors
- SRBP2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SRBP2_HUMAN | 3.11 | n/a | 3.00 | 0.63 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
