rs6428600 chr1:90726740 C>G
- Sequence
aatatgcttttcctccccgccctc[C/G]gcatggctgcctgcgcttcctcca
- ASB in cell types
- GM23248 hepatocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 1.45 | 4.06 | 1.00 | |||
| hepatocytes | 1.59 | -1.35 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), college completion, ldl cholesterol, microalbuminuria, refractive error, waist hip ratio