rs6429133 chr1:239308883 G>C
- Sequence
aaaacgctgttgaaagttagaagc[G/C]tgcattcagctctagagggcgcgc
- ASB in cell types
- Jurkat (T-cells) HEK293 (embryonic kidney) GM10847 (female B-cells Lymphoblastoid Cell Lines) GM12892 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.71 | 1.21 | 1.41 | n/a | No Hit | |||
| STAG1_HUMAN | 1.70 | -0.23 | 1.17 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, hdl cholesterol change with statins, ldl cholesterol change with statins, tardive dyskinesia, waist hip ratio