rs6429931 chr2:141911833 A>G
- Sequence
tcatgctgtgagggactggtctca[A/G]tgcacacctgtggaagagtctcaa
- ASB in cell types
- HMEC (human mammary epithelial cells) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HMEC (human mammary epithelial cells) | 1.52 | -0.16 | 1.00 | |||
| foreskin keratinocyte | 0.84 | n/a | 2.67 |
Items per page:
1 – 2 of 2