rs6430614 chr2:136256360 G>A
- Sequence
gagctctgccttgaggtaaacatg[G/A]tcctagctgattgacaatcctgct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 2.10 | -1.05 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, diastolic blood pressure (dbp), fasting insulin, hdl cholesterol change with statins, ldl cholesterol, mitral annular calcium, resistance to kuru in aged women despite likely exposure, systolic blood pressure (sbp), total cholesterol, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Esophagus_Mucosa, Esophagus_Muscularis