rs6431590 chr2:238256487 A>G
- Sequence
gaacactcagccaccaatgcgctc[A/G]ttgtaaatctgtttaccacctgta
- ASB in cell types
- GM17942 (lymphoblastoid cell) GM19099 (female B-cells Lymphoblastoid Cell Lines) PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM17942 (lymphoblastoid cell) | -1.78 | 2.17 | 1.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.92 | -1.61 | 1.00 | |||
| PC9 (lung adenocarcinoma) | 1.10 | -0.32 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Vagina, Whole_Blood