rs6431846 chr2:7083994 A>T
- Sequence
ggtaaggggagttcatctctcacc[A/T]cctcctccatttcccgctcctcag
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.29 | -1.19 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | 0.64 | -1.93 | 1.33 |
Items per page:
1 – 2 of 2