rs6432267 chr2:12178340 G>A
- Sequence
gagactgtgcatttggtggaaaga[G/A]tatggaatttgaaactgtgtagtt
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.03 | 0.15 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), bipolar disorder, combined control dataset, ldl cholesterol, major depressive disorder, total cholesterol, transmission distortion, triglycerides:hdl cholesterol ratio